adulteration

13 Home Kits to Detect Food Adulteration – Read Easy

by with No Comment Food Technology

know the basic techniques to detect food adulteration at your home and tests to detect it

Home Kit to Detect Food Adulteration

Turmeric Powder

adulteration
Turmeric Powder

Adulteration – Yellow Aniline Dyes

Test – Shake a little Turmeric powder (Suspended in Water) with a solution of Rectified spirit.

Observation & Inference – The solution turns yellow immediately.

Principle – The Yellow aniline dyes separate on adding rectified spirit.

          Harmful Effects – Carcinogenic.

Sweets, Juices, Jams

Jams
juices

Adulteration – Non-permitted coal tar dye (Metanil Yellow).

Test – To the sample add hot water and to the separated colouring matter, adds a few drops of HCl.

Observation & Inference – Pinkish Red colour shows the presence of Metanil yellow.

Principle – On adding HCl, the structure of Metanil yellow gives a pink colour at low pH.

Harmful Effects – Metanil yellow is toxic and Carcinogenic.

Wheat & other food grains

Wheat

Adulteration – Ergot (A Fungus containing a poisonous substance).

          Test –To the sample add common salt solution and shake.

Observation & Inference – The impurity ergot floats on top while the pure food grains settle at the bottom.

Principle – (-)

Harmful Effects – Poisonous

Black Pepper

Black Pepper

Adulteration – Papaya Seeds.

Test – Smell Pepper, Examine with a magnifying lens.

Observation & Inference – Papaya seeds have a repulsive flavour; Examine with a magnifying lens.

Principle – (-)

          Harmful Effects – Stomach, Liver problems.

Adulteration – Rotten pepper and light berries.

Test – Add a little solution of Rectified spirit to the sample.

Observation & Inference – Rotten pepper, Papaya seeds and light berries float.

Principle – (-)

Harmful Effects – Stomach, Liver problems.

Chilli Powder

Chilli Powder

Adulteration – Brick Powder.

Test – Add water to the powder and shake.

          Observation & Inference – The brick powder settles down.

Principle – Due to the heaviness, brick powder settles down. The brick powder contains calcium salts which give brick red flame.

Harmful Effects – Stomach Problems.

Adulteration – Brick Powder.

Test – To a little powder add concentrated HCl introduce as paste into flame through the backside of a matchstick.

Observation & Inference – The brick red flame colour is due to the presence of calcium salts in brick powder.

Principle – Due to the heaviness, brick powder settles down. The brick powder contains calcium salts which give brick red flame.

Harmful Effects – Stomach Problems.

Adulteration – Artificial Colours.

Test – Sprinkle the chilli powder on a glass of water.

Observation & Inference –  Artificial colourants descend in coloured streaks.

Principle – (-)

Harmful Effects – Toxic.

Asafoetida

Asafoetida

Adulteration – Foreign resins galbanum, Colophony resin.

Test – Powder a gram of Asafoetida and shake it with a solution of Rectified spirit. Filter the extract and to 5 mL of it, add the solution of FeCl3.

Observation & Inference – Olive Green colour shows the presence of foreign resins.

Principle – Colophony is a resin obtained as a residue after the distillation of Turpentine oil. This forms a coloured complex when shaken with Rectified spirit and Ferric Chloride.

Harmful Effects – Allergy, Dysentery.

Test – Burn on a spoon (Like Camphor).

Observation & Inference –  Burns like camphor shows a pure sample.

Principle – Pure Asafoetida burns quickly like aromatic camphor.

Harmful Effects – (-)

Honey

Honey

Adulteration – Sugar plus Water.

Test – A cotton wick dipped in honey is burnt.

Observation & Inference – If adulterated with water, the honey will not burn or burn with a cracking sound.

Principle – Due to the presence of water, the wick does not burn or form a cracking sound.

Harmful Effects – (-)

Adulteration – Invert Sugar

Test – Add Resorcinol and HCl.

Observation & Inference – The red colour is obtained.

Principle – When honey is adulterated with invert sugar (Glucose and Fructose) on adding Resorcinol and HCl, red colour is obtained.

Harmful Effects – (-)

Cloves

Cloves

Adulteration – Cloves from which volatile oil has been extracted.

          Test – Examine with a magnifying lens.

Observation & Inference – Can be identified by the small size and shrunken appearance. The adulterated cloves are less pungent.

Principle – (-)

Harmful Effects – (-)

Jaggery

Jaggery

Adulteration – Washing Soda.

Test – Add a few drops of a solution of HCl.

Observation & Inference – Effervescence shows the presence of washing soda.

Principle – Washing soda, a base reacts with hydrochloric acid and liberates CO2 which gives effervescence.

Harmful Effects – Diarrhoea, Vomiting.

Adulteration – Chalk Powder.

Test – Dissolve a little sample in water in a test tube.

Observation & Inference – Chalk powder settles down.

Principle – (-)

Harmful Effects – (-)

Test – Add a few drops of a solution of concentrated HCl.

Observation & Inference – Effervescence indicates the presence of an adulterant.

Principle – Chalk powder contains carbonates of magnesium and calcium. These carbonates react with HCl and liberate CO2 with effervescence.

CaCo3 + 2HCl —> CaCl2 + H2O + CO2

Harmful Effects – Liver Disorder.

Common Salt

Common Salt

Adulteration – Chalk Powder or White powdered stone.

Test – Dissolve a little sample in water.

Observation & Inference – The solution turns white indicating the presence of chalk and other impurities settle down.

Principle – Chalk powder contains carbonates of magnesium and calcium which are insoluble in water and hence the solution turns white.

Harmful Effects – Stomach Disorder.

Mustard Seeds

Mustard Seeds

Adulteration – Argemone Seeds.

Test – Examine with a magnifying lens.

Observation & Inference – Mustard seeds have a smooth surface while the argemone seeds have a rough surface and are blacker in colour.

Principle – (-)

Harmful Effects – Oedema (Dropsy).

Silver Leaves

Adulteration – Aluminium Leaves.

Test – Burn the leaves in flame.

Observation & Inference – Pure silver leaves burn away completely leaving glistening balls while aluminium leaves are reduced to grey ash.

Principle – (-)

Harmful Effects – (-)

Supari

Betel Nuts

Adulteration – Colours and Saccharin.

Test – Add water to the sample.

Observation & Inference – Colour dissolves in water. Saccharin gives the characteristic sweet taste.

Principle – (-)

Harmful Effects – (-)

Check out for other posts on Home Kit to Detect Food Adulteration – Part 1

For more details about various courses, check out Ampersand Academy.

Food Adulteration

2 Min Home Kit to Detect Food Adulteration – Easy Read

by with 2 Comments Food Technology

know the basic techniques to detect food adulteration at your home and tests to detect it

Home Kit to Detect Food Adulteration

Home Kit helps to detect food adulteration for detecting common adulterants in essential food commodities. The kit has brought the lab to the kitchen by simplifying the different chemical tests. Even a layperson or housewife can detect food adulteration at home to make sure that they buy good food items. The tests require only the addition of solutions and visual observation. The handy kit can be used anywhere to create public awareness and educate people about buying unadulterated foodstuff. The kit, widely hailed in the media, can be used in every household to ensure healthy and safe food.

      A few simple tests described below educate the common person about the various adulterants, the methods of detecting them with the chemistry of the tests, and the harmful effects of the particular adulterants.

FOOD ARTICLES

Coffee Powder

Food Adulteration
Coffee

Adulteration – Chicory Powder (Without declaration).

Test – Sprinkle the powder on the surface of the water in a test tube.

Observation & Inference – The pure coffee powder floats while the chicory begins to sink with a reddish colour.

Principle – The chicory root has a characteristic structure, and it dissolves in cold water due to the presence of inulin. Inulin hydrolyses to give fructose, and the fructose on treatment with HCl and resorcinol (0.5%) provides a red coloured complex. Fructose with HCl gives hydroxymethyl furfural which combines with resorcinol to form a red colour.

Harmful Effects – Stomach disorder, Giddiness and joint pain (in some cases).

Food Adulteration – Tamarind seed, Date Seed Powder.

Test – Sprinkle the coffee powder on a filter paper and add the solution of Sodium carbonate.

Observation & Inference – Red colouration shows the presence of tamarind or date seed powder.

Principle – Sodium Carbonate is a mild base. On adding, colour separation takes place due to the change in pH of the solution.

Harmful Effects – Diarrhoea.

Tea

Food Adulteration
Tea

Food Adulteration – Used up tea leaves Coloured outer coats of Dhal and some Colourants.

Test – Sprinkle tea powder on a wet filter paper.

Observation & Inference – Colour separation shows the presence of adulteration.

Principle –  The coloured adulterants are banned; coal tar dyes separate on adding water as streaks on the filter paper. Genuine samples will not stain on the paper.

Harmful Effects – Liver Disorder.

Milk

Milk

Adulteration – Starch.

Test – Add a little water to the sample and boil for a few minutes. Cool and add iodine.

Observation & Inference – Blue colouration shows the presence of starch.

Principle – The blue colour is due to the formation of an inclusion complex between iodine and the amylose fraction of the starch. The linear amylose coils into a spiral, and the iodine molecule aligns within the centre of the spiral and causes light absorption that gives a blue colour.

Harmful Effects –  (-)

Food Adulteration – Water.

Test – Allow the milk to flow over a vertical polished surface.

Observation & Inference – The milk flows freely without leaving a trail when the water content is more. Pure milk will leave a trail.

Principle – (-)

Harmful Effects –  (-)

Sugar

Sugar

Food Adulteration – Chalk Powder.

Test – Dissolve the sugar in a glass of water.

Observation & Inference – Chalk powder will not dissolve.

Principle – Sugar C12H22O11 is water-soluble, white chalk powder contains Calcium carbonate and Magnesium carbonate, which are insoluble in water.

Harmful Effects – Liver Disorder.

Bura Sugar

Bura Sugar

Food Adulteration – Washing Soda.

Test – Add water and dip red litmus paper in the solution.

Observation & Inference – Blue colour shows the presence of washing soda.

Principle – Washing soda is sodium carbonate (Na2CO3), a base and hence gives blue colour with red litmus. Sodium carbonate a base reacts with hydrochloric acid, a reaction between acid and base, with the evolution of Carbon dioxide, which gives effervescence.

Na2CO3 + 2HCl —–> 2 NaCl + H2O + CO2

Harmful Effects – Diarrhoea, Vomiting.

Test – Take a little bura sugar in a test tube and add a few drops of a dilute solution of Hydrochloric acid (HCl).

Observation & Inference – Effervescence indicates the presence of an adulterant.

Principle – (-)

Harmful Effects –  (-)

Edible Oils

Edible Oils

Adulteration – Argemone Oil.

Test – Treat the sample with solution Ferric chloride in the presence of a dilute solution of Hydrochloric acid. Observe through a lens.

Observation & Inference – Needle shaped brown crystals show the presence of Argemone oil.

Principle – Argemone oil contains the alkaloids sanguinarine and dihydrosanguinarine, which are toxic. These react with FeCl3 and HCl to give brown colour. Argemone oil on treatment with Concentrated HNO3 will provide a red colouration since these alkaloids turn red with HNO3.

Harmful Effects –  Dropsy Gastrointe Gastrointestinal problems, Fever, Swelling of feet and legs, Oedema, Glaucoma, Respiratory distress, Cardiac arrest.

Food Adulteration – Mineral Oil.

Test – To the sample, add a little alcoholic solution potash and warm for 10 minutes. Then add water.

Observation & Inference – Turbidity shows the presence of mineral oil.

Principle – Alcoholic potash KOH will saponify the esters in oil. Still, the mineral oils which originate from Petroleum are not saponifiable by the alkaline KOH and hence on adding water gives turbidity while pure oil will saponify.

Harmful Effects –  Damage to liver, Carcinogenic effects.

Food Adulteration – Karanja Oil (Pungam Oil).

Test – To two drops of the oil, add a solution of Antimony trichloride in chloroform.

Observation & Inference – The appearance of yellow to orange colour immediately shows the presence of Karanja oil.

Principle – The non-saponifiable components of the oil react with Antimony trichloride SbCl3/CHCl3to form a yellow to orange coloured complex.

Harmful Effects –  Heart problems, liver damage.

Food Adulteration – Castor Oil.

Test – To the sample, add petroleum ether solution and then cool in ice.

Observation & Inference – White turbidity shows the presence of castor oil.

Principle – Castor oil contains the triglyceride component triricinolein, which gives white turbidity on treatment with petroleum ether.

Harmful Effects – Stomach problems.

Ghee & Butter

Ghee & Butter

Food Adulteration – Vanaspati

Test – To a little amount of the melted ghee or butter in a test tube, add equal amounts of solution HCl, add a little sugar, and shake vigorously. Keep it standing for 5 minutes.

Observation & Inference – The appearance of a crimson red colour shows the presence of vanaspati.

Principle – This test is characteristic of sesame oil which is added to vanaspati. The phenolic substance sesamol reacts with the fructose formed by the hydrolysis of cane sugar and gives a red colour.

Harmful Effects – Liver disorder and Stomach pain.

Food Adulteration – Mashed potatoes and other starches.

Test – Add a little solution of iodine to the sample.

Observation & Inference – Blue colouration shows the presence of starch.

Principle – Iodine forms a blue coloured inclusion complex with the amylose fraction of the starch.

Harmful Effects – (-)

Dhal

Dhal

Food Adulteration – Kesari Dhal and Toxic dyes.

Test – Examine the dhal with a magnifying lens.

Observation & Inference – Kesari dhal has a convoluted shape while ordinary dhal has a smooth round appearance.

Principle – (-)

Harmful Effects – Bent knees, Paralysis, Neurotoxic.

Test – To the sample, add a solution of concentrated HCl. Keep in a water bath for 15 minutes.

Observation & Inference – Pale red colour shows the presence of Kesari dhal or toxic dyes.

Principle – Kesari dhal is Lathyrus sativus, which contains beta-oxalyl amino alanine (BOAA), a toxic amino acid. On adding HCl, colour separation takes place since the toxic dyes are non-permitted colours.

Harmful Effects – Toxic dyes are Carcinogenic.

Pulses (Green Peas and Dhal)

Pulses

Food Adulteration – Colour dyestuffs.

Test – Keep the sample immersed in water for about half an hour and stir.

Observation & Inference – Colour separation indicates adulteration.

Principle – The non-permitted colours like Malachite green, Congo Red is Yellow aniline dyes that show colour separation.

Harmful Effects – Stomach pain, Ulcer, Liver Problems, Tumour.

Check out for other posts on Food technology

For more details about various courses, check out Ampersand Academy.

iron and calcium

Iron and calcium – Major Vital Supplements for Women and Children; Read Easy in 3 Mins

by with No Comment Food Technology

Know about the vital aspects of Iron and Calcium for women and children

Iron and Calcium

Iron and Calcium are the essential minerals that are required as an enhancement for Women and children. When all is said, many individuals encourage children to take dairy items for Calcium and Date Palm for Iron.

Dairy items, for example, Milk and Curd, are accounted for to have high calcium substances, and Date Palm is accounted for having high iron substances.

Besides, these two Iron and Calcium are promptly accessible. Although these two Iron and Calcium are plentiful in fundamental minerals, it is improbable that individuals realise that these two Iron and Calcium ought not to be expended simultaneously.

It is a typical practice in India that these two Iron and Calcium are devoured together. By and large, Date syrup is blended in with Milk and served to children during the previous night they rest.

Sources of Calcium-Rich Foods

  • Milk,
  • Cheese and other dairy foods.
  • Yogurt.
  • Green leafy vegetables – such as curly kale, okra.
  • Soya drinks with added calcium.
  • Bread and anything made with fortified flour.
  • Fish where you eat the bones – such as sardines and pilchards.
  • Beans and lentils.
  • Almonds.
  • Whey Protein
  • Figs.
iron and calcium
Sources of calcium-rich foods

This training will not do the trick to build the iron substance in the body because expanded Calcium aggregated because of admission as Calcium salts or dairy items will restrain iron retention.

The other way around the expanded admission of Iron through nourishment or tablets will repress the ingestion of Calcium.

This has caused a worry as expanded Calcium consumption is regularly suggested for children and ladies, similar peoples in danger of iron inadequacy.

Numerous studies were performed to check whenever delayed admission of Calcium hinders iron assimilation and the other way around. There were conflicting discoveries which do not bolster this announcement.

Nonetheless, it is savvy to control devouring Calcium – using salts, tablets or dairy items – and Iron together since it will probably create a killing impact.

How much calcium a person need?

Adult men 51-70 years: 1,000 mg. Adult women 51-70 years: 1,200 mg. Adults 71 years and older: 1,200 mg. Pregnant and breastfeeding teens: 1,300 mg.

What is Calcium Deficiency Disease?

Calcium is a vital mineral. The body uses it to build robust bones and teeth. Calcium is also required for the heart and muscles to function properly.

When we do not get enough calcium, the risk of developing disorders like:

  • Osteoporosis
  • Osteopenia
  • Hypocalcemia

Children who do not get sufficient calcium may not grow to their full potential height as adults.

People should consume the recommended amount of calcium per day through their food, supplements, or vitamins.

iron and calcium
Foods rich in Iron

Sources of Iron Rich Foods

  • Red meat, pork and poultry.
  • Seafood.
  • Beans.
  • Dark green leafy vegetables, such as spinach.
  • Dried fruit, such as raisins and apricots.
  • Iron-fortified cereals, breads and pastas.
  • Peas.
  • Spinach.
  • Legumes.
  • Pumpkin seeds.
  • Quinoa.
  • Broccoli.
  • Tofu.
  • Dark Chocolate.

How much Iron a person need?

The amount of iron you need is 8.7 mg a day for men over 18. 14.8 mg a day for women aged 19 to 50. 8.7mg a day for women over 50.

What is Iron Deficiency Anaemia?

Anaemia occurs when you have a dwindled level of haemoglobin in your red blood cells (RBCs).

 Haemoglobin is the protein in the RBCs that is responsible for carrying oxygen to the tissues.

Iron deficiency anaemia is the most communal type of anaemia, and it occurs when your body does not have a sufficient amount of iron. Your body needs iron to make haemoglobin.

When there is insufficient iron in the bloodstream, the rest of the body cannot get the oxygen it needs.

While the condition may be common, many individuals do not know they have iron deficiency anaemia.

In women of childbearing age, the very common reason for iron deficiency anaemia is a shortfall of iron in the blood owing to heavy menstruation or pregnancy.

An inadequate diet or certain intestinal diseases that affect how the body absorbs iron can also cause iron-deficiency anaemia.

Doctors usually treat the disorder with iron supplements or changes to diet.

Symptoms of Iron Deficiency Anaemia

  • Fatigue.
  • Pale skin.
  • Shortness of breath.
  • Dizziness.
  • Weakness.
  • A tingling and crawling feeling in the legs.
  • Tongue swelling and soreness.
  • Cold hands and feet.
  • Fast or irregular heartbeat.
  • Brittle nails.
  • Headaches.

Therefore, both Iron and Calcium plays a major role as vital supplements in woman and children. So, all adults including males and females and especially children should follow adequate amounts of iron and calcium on daily basis.

Check out for other posts on Food technology

For more details about various courses, check out Ampersand Academy.

Vitamin D

Easy 3 Min Read on Vitamin D

by with No Comment Food Technology

Know about the vital aspects and importance of Vitamin D and deficiency caused in absence of Vitamin D

Vitamin D  is conceivably the absolute most undervalued supplement in the world of sustenance. That is presumably, cause it is free.

The body makes it when sunlight contacts the skin. Drug organisations cannot sell sunlight, so there is no advancement of its health benefits.

Indeed, the vast majority do not know the accurate description of “Vitamin D and health.”

  • Vitamin D  is generated by the skin in retort to contact with ultraviolet radiation from natural sunlight.
  • The recuperating beams of natural sunlight (that create vitamin in your skin) cannot infiltrate glass. In this way, the body does not generate Vitamin when sitting in a vehicle or home.
  • It is almost difficult to get adequate measures of Vitamin from the diet. Sunlight presentation is the first dependable approach to produce Vitamin in your own body.
  • An individual would need to drink ten tall glasses of vitamin fortified milk every day to get least degrees of Vitamin into their food.
  • The further, you subsist from the equator, the more prolonged presentation you need to the sun to produce this particular vitamin. Canada, the UK and most U.S. States are a long way from the equator.
  • Individuals with dark skin pigmentation may need 20 – 30-fold the amount of introduction to sunlight as reasonable skinned individuals to produce a similar measure of Vitamin D. That is the reason the prostate disease is epidemic among dark men – it is an essential, yet widespread, sunlight deficiency.
  • Sufficient degrees of Vitamin D  is critical for calcium assimilation in digestion tracts. Without adequate Vitamin, the body cannot assimilate calcium, rendering calcium supplements pointless.
  • Chronic deficiency cannot be reversed medium-term: it takes a very long time of Vitamin D supplementation and sunlight introduction to rebuilding the body’s bones and sensory system.
Vitamin D
Sunlight is the chief source
  • Even feeble sunscreens (SPF=8) hinder your body’s capacity to produce Vitamin D by 95%. It is how sunscreen products cause disease by making an underlying Vitamin D efficiency in the body.
  • It is challenging to create a lot of this particular vitamin in your body from sunlight introduction: your body will self-control and produce what it needs.
  • If it damages to press immovably on the sternum (chest/bosom bone), you might be experiencing ceaseless deficiency at present.
  • Vitamin D is ” triggered ” in your body by your kidneys and liver before it tends to be used.
  • Having kidney disease or liver damage can significantly weaken the body’s capacity to actuate flowing Vitamin D.
  • The sunscreen industry does not need, to realise that the body needs sunlight introduction since that acknowledgement would mean lower offers of sunscreen products.
  • Even however,  it is one of the most dominant mending synthetic substances in the body, the body makes it free. No solution required. Other ground-breaking antioxidants with this capacity include super-organic products like Pomegranate, Acai, Blueberries.

Diseases and Deficiency

  • Osteoporosis caused by an absence of this particular vitamin, which incredibly disables calcium ingestion.
  • Sufficient Vitamin D counteracts prostate malignancy, bosom disease, ovarian malignancy, depression, colon malignant growth and schizophrenia.
  • “Rickets” is the name of a bone-squandering disease caused by this vitamin deficiency.
Vitamin D - Rickets
Rickets
  • Deficiency may intensify type 2 diabetes and debilitate insulin production in the pancreas.
  • Obesity debilitates Vitamin D use in the body, which means stout individuals need twice as a lot of Vitamin D.
  • Vitamin D is used around the globe to treat Psoriasis (a persistent skin disease).
Vitamin D - psoriasis
Types of Psoriasis
  • A seasonal affective disorder caused by a melatonin irregularity initiated by the absence of presentation to sunlight.
  • Chronic deficiency frequently misdiagnosed as “Fibromyalgia” because its manifestations are so comparable: muscle shortcoming, a throbbing painfulness.
  • The danger of developing certain diseases like Diabetes and Cancer reduced by half – 80% through a primary, reasonable presentation to natural sunlight 2-3 times every week.
  •  Infants who get supplementation (2000 units daily) have an 80% reduced danger of developing Type 1 Diabetes throughout the following twenty years.
Vitamin D - Sources
Healthy foods containing vitamin D. Top view

Vitamin D Deficiency facts

  • 32% of doctors and medical school students are deficient.
  • 40% of the U.S. populace are deficient.
  • 42% of African American ladies of childbearing age are deficient.
  • 48% of youngsters, especially girls from 9-11 years of age, are deficient.
  • 60% of all medical clinic patients are deficient.
  • 76% of pregnant moms are seriously deficient, causing prevalent deficiencies in their unborn children, which influences them to Type 1 Diabetes, Arthritis, Multiple Sclerosis and Schizophrenia sometime down the road. 81% of the children destined to these moms were deficient.
  • 80% of nursing patients are deficient
  • 90% of the Indians are deficient.

STOP APPLYING SUNSCREEN CREAM

Check out for other posts on Food technology

For more details about various courses, check out Ampersand Academy.

colour additives types and regulations

3 Min Read on Colour Additives Types and Regulations – An Easy Guide

by with No Comment Food Technology

know about the colour additives types and regulations and diseases caused by the usage of colour additives

Colour Additives-What is it? 

Colour additives are dyes, pigments, or substances that bestow colour to food, drug, or the human body in order to make them attractive.

​​​​​​​Types of Colour Additives

Natural Additives

Natural food colour additives are extracted from vegetables or minerals that help in colouring food substances. Seeds, fruits, vegetables and algae are used for the extraction of dyes. These additives maintain the standards of colour additives types and regulations.

Different Natural Colours

  • Red, Blue and Violet: Anthocyanins found in beetroots, raspberries and red cabbages.
  • Green: Chlorophylls found in all leaves and stems.
  • Yellow, Orange, Red: Carotenoids found in Tomatoes Apricots and  Carrots.

Synthetic Colour Additives Types and Regulations

These are artificial colouring agents that are manufactured by chemical reactions and are commonly used in the food and pharmaceutical industries.

Some of the standard food colours are Tartrazine, Sunset Yellow, Amaranth, Allura Red, Quinoline Yellow, Brilliant Blue and Indigo Carmine.

Some of the primary colour additives types and regulations leveraged in the industries are

Brilliant Blue, E133 (Blue shade)

Indigotine, E132 (Dark Blue shade)

Fast Green, E143 (Bluish-green shade)

Allura Red AC, E129 (Red shade)

Erythrosine, E127 (Pink shade)

Tartrazine, E102 (Yellow shade)

Sunset Yellow, E110 (Orange shade)

colour additives types and regulations
E Numbers
colour additives types and regulations

Psychological Properties of Food Color Additives Types and Regulations

Red


Psychological Association: Physical


Positive: Physical courage, strength, warmth, energy, basic survival, ‘fight or flight’, stimulation, masculinity, excitement.


Negative: Defiance, aggression, visual impact, strain.


Blue


Psychological Association: Intellectual


Positive: Intelligence, communication, trust, efficiency, serenity, duty, logic, coolness, reflection, calm


Negative: Coldness, aloofness, lack of emotion, unfriendliness


Yellow


Psychological Association: Emotional


Positive: Optimism, confidence, self-esteem, extraversion, emotional strength, friendliness, creativity


Negative: Irrationality, fear, emotional fragility, depression, anxiety, suicide


Green


Psychological Association: Balance


Positive: Harmony, balance, refreshment, universal love, rest, restoration, reassurance, environmental awareness, equilibrium, peace


Negative: Boredom, stagnation, blandness, enervation


Violet (Purple)


Psychological Association: Spiritual


Positive: Spiritual awareness, containment, vision, luxury, authenticity, truth, quality.


Negative: Introversion, decadence, suppression, inferiority


Orange


Positive: Physical comfort, food, warmth, security, sensuality, passion, abundance, fun


Negative: Deprivation, frustration, frivolity, immaturity


Pink


Positive: Physical tranquility, nurture, warmth, femininity, love, sexuality, survival of the species


Negative: Inhibition, emotional claustrophobia, emasculation, physical weakness


Grey


Positive: Psychological neutrality


Negative: Lack of confidence, dampness, depression, hibernation, lack of energy


Black


Positive: Sophistication, glamour, security, emotional safety, efficiency, substance


Negative: Oppression, coldness, menace, heaviness


White


Positive: Hygiene, sterility, clarity, purity, cleanness, simplicity, sophistication, efficiency


Negative: Sterility, coldness, barriers, unfriendliness, elitism


Brown


Positive: Seriousness, warmth, Nature, earthiness, reliability, support


Negative: Lack of humour, heaviness, lack of sophistication

Color Order Chart

Used in

  •     Bakery
  •     Beverage
  •     Confectionery
  •     Pharmaceutical Products
  •     Blended food colours
  •     Dairy & Icecream
  •     Cosmetics & Toiletries
  •     Soft Drink Concentrates
  •     Squashes
  •     Medicines
  •     Seafood
  •     All Edible preparations
colour additives types and regulations

Regulations for food colour additives

The Food Safety and Standards Authority of India (FSSAI), which is a statutory body under the Food Safety and Standards Act, 2006, controls and ensures food safety standards in food colour additives types and regulations. FSSAI has set forth safety regulations for the usage of food colours.

FDA is accountable for regulating all colour additives types and regulations to ensure that foods containing colour additives are safe to eat, contain only approved ingredients and are accurately labelled.

Food additives represented by the manufacturers are put on the labels in the form of codes called E- numbers. The E number range for colours is from E100- E199.

Colour additives functions and benefits

Colour additives can ensure flavour in all the food items from candy to wine, enhance colour, correct natural variations in colour, make food more appetising and informative, and ensure the consistency and visual decoration of the product.

Harmfulness of colour additives

While there are several benefits of colour additives types and regulations agencies have predicted that these colour additives can cause highly dangerous diseases such as ADHD, Cancer, Hypersensitivity.

  1. ADHD: Attention Deficit Hyperactivity Disorder is solitary of the highly common mental disorders, noticed in children who can continue to their adolescence and adulthood. ADHD characterised by hyperactivity, unable to focus on things or to pay attention. Many sources predict that ADHD caused due to increased intake of foods that contain colour additives. Therefore, it is advisable to reduce the consumption of foods that contain harmful and excessive colour additives. All the parents should be aware of what their children are having and see to that they do not consume colour additive added foods.
  2. Cancer: Cancer has become the buzz word these days, owing to several cancer cases. Though there is no evidence that these additives result in cancer, many closed survey and research proved excessive intake of additives add might result in tumour and cancer

Following is the detailed list of colour additives and their harmful effects

AdditivesHarmful Effects
FD & C BLUE 1Genotoxicity, Carcinogenicity, Neurotoxicity
FD & C BLUE 2Genotoxicity, Carcinogenicity
CITRUS RED 2Bladder Carcinogen
ORANGE- BChronic Toxicity
FD & C RED 40Hypersensitivity, Carcinogen
FD & C YELLOW 5Asthma, Urticarial, Hypersensitivity effects
FD& C YELLOW 6Hypersensitivity, Carcinogenicity, Behavioural effects

For more details about various courses, check out Ampersand Academy.

WHAT IS BLAST

Easy Tutorial on WHAT IS BLAST in 2 mins

by with No Comment Bioinformatics

Learn WHAT IS BLAST

BLAST is an acronym for Basic Local Alignment Search Tool. Despite the adjective ” Basic” in its name, BLAST is a sophisticated software package that has become the single most important piece of software in the field of bioinformatics. There are several reasons for this. First, sequence similarity is a powerful tool for identifying the unknowns in the sequence world. Second, BLAST is fast.

The sequence world is big and growing rapidly, so speed is important. Third, BLAST is reliable, from both a rigorous statistical standpoint and a software development point of view. Fourth, BLAST is flexible and can be adapted to many sequence analysis scenarios. Finally, BLAST is entrenched in the bioinformatics culture to the extent that the word “blast” is often used as a verb. There are other BLAST-like algorithms with some useful features, but the historical momentum of BLAST maintains its popularity above all others.

WHAT IS BLAST
WHAT IS BLAST

Although BLAST originated at the National Center for Biotechnology Information (NCBI), its development continues at various institutions, both academic and commercial. This can be a little confusing, especially because people often put prefixes or suffixes on the acronym to come up with names like XYZ-BLAST-PDQ.

We have aimed to keep this book as simple as possible, and therefore we concentrate on the two most popular versions: NCBI-BLAST and WU-BLAST (pronounced ” woo blast”). NCBI-BLAST, as the name suggests, is the version available from the NCBI. WU-BLAST comes from Washington University in St. Louis and is developed by Warren Gish, one of the original authors of BLAST.

The NCBI, some portion of the National Institutes of Wellbeing, is a U.S. government-supported community for the curation and introduction of open natural information. The NCBI is an open archive for DNA and protein arrangements (GenBank), however, it’s unquestionably something other than an information storage facility.

The NCBI additionally keeps up an exhaustive medicinal production file (PubMed), disperses numerous apparatuses for organic examinations (NCBI tool kit), and assembles its very own instruments for utilizing the information that it stores (LocusLink, UniGene, RefSeq, Taxonomy program). In particular, for our motivations, it’s the place the BLAST calculation was first created (Altschul et al., 1990) and where it very well may be gotten, conveyed, and utilized for nothing without confinements.

Anybody with access to the Internet can run a BLAST seek and investigate the plenty of hereditary assets that have been amassed and curated by the NCBI throughout the years. You’ll capitalize on this section in the event that you track with an internet browser. Start by setting off to the BLAST landing page at http://www.ncbi.nlm.nih.gov/BLAST.

Now that you have learnt about What is Blast, If you want to learn Bioinformatics as coursework with a certificate. Check our Bioinformatics course from Ampersand Academy. Also, read about Choosing the Blast Program.

Choosing the BLAST Program

Complete guide on Choosing the BLAST Program in 2021

by with No Comment Bioinformatics

Learn Choosing the BLAST Program

Without describing the majority of the choices introduced on the homepage, how about we get directly into it with a default BLASTN look. Pick “Standard nucleotide-nucleotide BLAST [blastn]”. BLASTN is a program that analyzes a nucleotide query sequence to a database of nucleotide arrangements.

Choosing the BLAST Program
Choosing the BLAST Program

Inputting the Query Sequence

In the wake of picking the sort of inquiry you need to perform, the subsequent stage is to characterize the sequence with which to seek. There are three choices for this: glue in the uncovered sequence, glue in a record in FASTA format, or enter a legitimate NCBI identifier. You can simply begin composing a sequence in the pursuit box; in any case, when the inquiry is done, there will be no identifier to depict the sequence you entered. After a few such inquiries, the absence of an identifier will make it hard to monitor which results go with which sequence. The second alternative enables you to characterize the sequence utilizing the FASTA format. in any case, the fundamental particulars are that it’s a content record starting with a more prominent than sign (>) trailed by an identifier and a definition line, which is then continued by the one-letter nucleotide or peptide sequence on subsequent lines. Let’s use the following sequence:

>KY436756.1 Metarhizium rileyi small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence TCCGTAGGTGAACCTGCGGAGGGACCATTACCGAGTTTACAACTCCCAAACCCCATGTGAACTTATACCC TTTTCCTGTTGCCTCGGCGGGTCATTTGCCCCGGACCGGGCTCGTCCAGAGCCCGCCCGGAAACAGGCGC CCGCCGCGGGACCGAAACTCTGTATCTCTTAGCCTTTGGCACGTCTGAGTGGAATCATACAAAAATGAAT CAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATG TGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCA TGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGCGGTTTGGTGTTGGGGGCCGGCGATTGTCAGCT GGGCCGCTCAGGCGGTTCCCTGCGGCGCCGCCCCCGAAATGAATTGGCGGCCCCGTCGCGGCCTCCTCTG CGTAGTAGCACAACCTCGCAACAGGAGCGCGGCGCGGCCACTGCCGTAAAACGCACAAACTTCTCCAAGA GTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

Now that you have learnt about Choosing the BLAST Program, If you want to learn Bioinformatics as coursework with a certificate. Check our Bioinformatics course from Ampersand Academy. Also, read about Bioinformatics Job Scope.

Biological Sequences

Easy Read on Biological Sequences in 2 Mins

by with No Comment Bioinformatics

If you are searching to know about biological sequences, here’s the answer for you.

Biological Sequences

Sequence similarity is an incredible asset for finding natural capacity. Similarly, as the old Greeks utilized near life structures to comprehend the human body and language specialists utilized the Rosetta stone to unravel Egyptian symbolic representations, today we can utilize relative sequence investigation to get genomes, RNAs, and proteins. Be that as it may, for what reason are natural sequences like each other in any case? The response to this inquiry isn’t straightforward and requires a comprehension of molecular and developmental science.

Central Dogma of Molecular Biology

Molecular biology begins with the Central Dogma of Molecular Biology, which depicts the way by which data contained in DNA is changed over to protein particles with explicit capacities. Expressed basically, the Central Dogma is: “from DNA to RNA to protein.”

Biological Sequences
Biological Sequences

Now that you’ve learnt Do bioinformatics need programming? If you want to learn Bioinformatics as coursework with a certificate. Check our Bioinformatics course from Ampersand Academy. Also, read about Biostatistics.

Culture Media Composition

Culture Media Composition – Easy Read in 2 min

by with No Comment Microbiology

to know in detail about culture media composition used in the field of microbiology

Culture Media

Microorganisms, like other living organisms, require necessary nutrients for the growth and sustenance of life. The food materials on which microbes are grown artificially in a lab is known as culture media.

Media is an environment provided artificially in a lab supplying the required nutrients for the growth of the microorganism.

Culture Media Composition

History

The first person to identify a culture media was Lazaro Spallanzani, and later it was Robert Koch who has developed the same.

Koch first used a cut, half-boiled potato as a base to grow the microbes. Soon, he discovered that the base of the potato, eaten away, then he started using Gelatin.

Gelatin was also not successful as it had a melting point of 21ºC  and on incubation gelatin became liquid. Later Mrs Hesse, wife of an associate of  Robert Koch, suggested the use of agar which she was suing in her jams and jellies.

The discovery of Agar was a turning point in the history of culture media composition.

Composition of culture media

Different types of culture media composition are identified to isolate, grow and identify them. Different culture media compositions are prepared depending on the nutrient requirement of the microbes.

The essential ingredients of a culture media are as follows

 Carbohydrates

Simple and complex sugars are used as a source of carbon and energy.

Examples: Glucose, Lactose, Sucrose

Peptone

Peptone is a source of nitrogen and minerals. It is a water-soluble product obtained from the breakdown of animal or plant protein, and it is a mixture of peptides and amino acids.

Examples: Meat, Soya Bean

Meat Extract

Meat Extract is an aqueous meat infusion made by soaking fresh beef in water and provides the organism with a further supply of vitamins, minerals, sulphates, sulphides essential for the growth of the organism.

Yeast Extract

Yeast Extract is an autolysate made from yeast cells, and it is a common ingredient of culture media due to the presence of the B complex.

Mineral salts

Salts of Sulphur, Magnesium, Phosphorous are used in the media for enzymatic functions.

Agar-Agar

Corneum geladium is a polysaccharide extracted from seaweed, algae belonging to the family Rhodhophyceae, and it contains two main polysaccharides agarose (70-75%) and agar protein (20-25%).

Agar-agar is used as a solidifying agent in the media agent in the media preparation, giving a solid surface for the growth of microorganisms.

Its unique property is that it sets below 40ºC and melts at 90-95ºC. Besides, not attacked by the microbes as it is not a nutrient.

Water

          Water is essential as it helps to dissolve all ingredients used for the preparation of the media. Deionized or distilled water is safe to use in the culture media as it is free from the inhibitory effect of chemicals.

For more details about various courses, check out Ampersand Academy.

Nutrients and Media

3 Types of Nutrients and Media – Learn Easy

by with No Comment Microbiology

know about the details of nutrients and media types such as macronutrients and micronutrients

Nutrients and Media

The substances from which the microbes synthesise new cellular materials and obtain energy are called nutrients.

These nutrients must be supplied as utilisable compounds that take part in the synthesis of new cellular compounds.

Types of Nutrients

The three different types of nutrients are as follows

  • Macronutrients
  • Micronutrients
  • Trace elements
Nutrients and Media

Macronutrients

Macronutrients are nutrients required in relatively large quantities. Macronutrients are the primary building blocks molecules for the growth of microbes and play an essential role in cell structure and metabolism and are weighed in grams per litre.

The significant macronutrients are Carbon (C), Nitrogen (N), Sulphur (S) and Phosphorus (P).

Carbon Source

Carbon source forms the basic skeleton for all organic molecules. These carbon-containing compounds are the energy source to synthesise new cellular components.

The different types of carbohydrates used are Glucose, Fructose and Starch.

Nitrogen Source

Nitrogen is the major component of amino acids and proteins and uses nitrogen to synthesise various enzymes. Nitrogen is the source present in nutrients and media to provide nutrition like protein.

When hydrolysed by enzymes, it breaks down into peptides and then into amino acids.

Peptone is a standard universal ingredient used as a nitrogen source in the preparation of all media.

Sulphur Source

 Sulphur is the main constituent present in nutrients and media of many sulphur-containing amino acids like Cysteine, Methionine.

Microbes use sulphur to make the components of coenzymes.

Phosphorus Source

Microbes obtain phosphates to synthesise PO4 ions to prepare teichoic acids, ATP, phospholipids, nucleic acids. ATP is an essential source of energy. Microbes accumulate PO4 granules in the form of metachromatic granules found in Corynebacterium diphtheriae.

Micronutrients

Micronutrients are present in nutrients and media required in relatively smaller quantities when compared to macronutrients.

They are the minor components of building block materials but are still essential for the growth of the microbes and are generally weighed in milligrams per litre.

The significant micronutrients are Potassium (K), Calcium (Ca), Magnesium (Mg), Iron (Fe).

Potassium  

Potassium is the principal source present in nutrients and media to provide inorganic cation in the cell and is required for ribosomes and enzymatic functions and the cofactors for some enzymes.

Calcium

Calcium acts as a cofactor acting as the cellular cation. During unfavourable conditions, it helps to form heat resistant spores. Calcium is deposited in the form of DPA.

Magnesium

Magnesium acts as an essential cellular cation, serving as a cofactor for many enzymatic functions, binding enzymes to the substrates and forming an Mg complex with ATP.

Iron

Iron is a vital constituent of cytochromes and other proteins and serves as a cofactor for many enzymatic functions. It is available to the cell in the form of siderophores.

Trace Elements

The nutrients and media which are used in tiny traces are trace elements and serve as a cofactor for many enzymatic functions. Generally, weighed in micrograms per litre.

The significant trace elements are Zinc (Zn), Molybdenum (Mo), Cobalt (Co), Manganese (Mg), Nickel (Ni).

Zinc

Zinc is used by the microbial cell for DNA & RNA polymerase enzymatic functions. It also helps in producing essential metabolites.

Molybdenum

Molybdenum is an essential component of Ferredoxin in the Nitrogenase enzyme present in all nitrogen-fixing bacteria. (Rhizobium)

Cobalt

Cobalt is an essential vital component of the Vitamin B12­ molecule.

Manganese

Manganese serves as an alternate capacity for Magnesium deficiency. Many soil bacteria reduce Mn+4 to Mn+2 and are also used in the synthesis of metabolites like antibiotics.

Nickel

Nickel is a cofactor for many enzymes.

For more details about various courses, check out Ampersand Academy.