Python for Bioinformatics: Easy Getting-Started Guide

Quick answer: Python is the most beginner-friendly programming language for bioinformatics. With Biopython, pandas and a FASTA file, you can parse sequences, compute GC content, translate DNA to protein and automate repetitive analyses in minutes.

Every bioinformatics workflow eventually runs into scripts, and Python is the language most tutorials, tools and labs use. The good news is that you do not need to be a full-time programmer to get value from it. This easy guide takes you from zero to your first sequence-analysis scripts.

Why Python for bioinformatics?

• Easy syntax: Python reads almost like English, so beginners can focus on biology instead of programming details.
• Biopython: a huge library with parsers for FASTA, FASTQ, GenBank and BLAST output.
• Data analysis ecosystem: pandas for tables, NumPy for numbers, and Jupyter Notebooks for interactive work.
• Huge community: most bioinformatics documentation and Q&A sites use Python examples.

If you are still deciding whether coding matters for your path, our posts on whether bioinformatics needs programming and if programming is essential are worth a look.

Install Python the easy way

Download the latest Python installer from python.org, tick the box that says Add Python to PATH, and install. That is the whole setup for beginners. For a step-by-step walkthrough, see our easy Python install tutorial.

Install Biopython

Open a terminal (Command Prompt or PowerShell) and run:

pip install biopython

Biopython is a collection of Python tools made specifically for biology. It can read sequence files, translate DNA, fetch records from databases, and run and parse BLAST results.

Your first script: read a FASTA file

Save a file called sequences.fasta with a couple of sequences (see our FASTA format guide if you need a refresher). Then write a small script:

from Bio import SeqIO

for record in SeqIO.parse("sequences.fasta", "fasta"):
    print(record.id, len(record.seq))

Run it with python script.py. It prints each sequence identifier and its length. That tiny pattern is the foundation of virtually every sequence-analysis script you will write.

Compute GC content

GC content is the percentage of G and C bases in a sequence. It matters for primer design and for identifying species in samples, because GC content varies widely between organisms. Here is a one-liner approach for each record:

from Bio import SeqIO

for record in SeqIO.parse("sequences.fasta", "fasta"):
    seq = record.seq.upper()
    gc = (seq.count("G") + seq.count("C")) / len(seq) * 100
    print(record.id, round(gc, 2))

Translate DNA into protein

Biopython can translate a coding DNA sequence into protein with one method:

from Bio.Seq import Seq

dna = Seq("ATGGTGCACCTGACTCCTGAG")
protein = dna.translate()
print(protein)

The translate() method applies the standard genetic code, so ATG becomes M (methionine) and so on, giving you the amino acid sequence for proteins.

Fetch sequences from NCBI

Biopython can also pull a record straight from one of the databases we list in our databases guide:

from Bio import Entrez

Entrez.email = "you@example.com"
handle = Entrez.efetch(db="nucleotide", id="NM_000518", rettype="fasta", retmode="text")
print(handle.read())

Replace NM_000518 with any accession number and your email, and the sequence comes back in FASTA format, which you can then save or analyze.

What to learn next

1. pandas basics for reading tables (like BLAST tabular output).
2. Jupyter notebooks to keep analyses and notes together.
3. BLAST through Biopython for automated sequence searches.
4. Multiple sequence alignment and trees, which build on the files and scripts above.

Frequently asked questions